https://www.tmplab.org/wiki/index.php?title=Cluster&limit=500&action=history&feed=atom
Cluster - Revision history
2024-03-29T05:30:30Z
Revision history for this page on the wiki
MediaWiki 1.30.1
https://www.tmplab.org/wiki/index.php?title=Cluster&diff=5463&oldid=prev
Samneurohack: /* Post Install */
2013-10-09T00:27:51Z
<p><span dir="auto"><span class="autocomment">Post Install</span></span></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class="diff-marker" />
<col class="diff-content" />
<col class="diff-marker" />
<col class="diff-content" />
<tr style="vertical-align: top;" lang="en">
<td colspan="2" style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan="2" style="background-color: white; color:black; text-align: center;">Revision as of 00:27, 9 October 2013</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l70" >Line 70:</td>
<td colspan="2" class="diff-lineno">Line 70:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>    </div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>    </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>*Noter les machines mises sur le reseau avec la correspondance ip/machine.</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>*Noter les machines mises sur le reseau avec la correspondance ip/machine.</div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">* Pour installer exfat :</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">  * sudo apt-get install python-software-properties</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">  * sudo add-apt-repository ppa:relan/exfat</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">  * sudo apt-get update</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">  * sudo apt-get install fuse fuse-exfat exfat-utils</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>== Guide de survie ==</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>== Guide de survie ==</div></td></tr>
</table>
Samneurohack
https://www.tmplab.org/wiki/index.php?title=Cluster&diff=5438&oldid=prev
Samneurohack: /* Guide de survie */
2013-10-05T22:49:02Z
<p><span dir="auto"><span class="autocomment">Guide de survie</span></span></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class="diff-marker" />
<col class="diff-content" />
<col class="diff-marker" />
<col class="diff-content" />
<tr style="vertical-align: top;" lang="en">
<td colspan="2" style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan="2" style="background-color: white; color:black; text-align: center;">Revision as of 22:49, 5 October 2013</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l90" >Line 90:</td>
<td colspan="2" class="diff-lineno">Line 90:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>** Se reconnecter sur un terminal détaché : screen -r</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>** Se reconnecter sur un terminal détaché : screen -r</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>** Lister les terminaux créée depuis un terminal détaché : CTRL-A "</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>** Lister les terminaux créée depuis un terminal détaché : CTRL-A "</div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">** Créer une autre instance de terminal detachable : CTR-A c</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>** Reference : http://www.linux-nantes.org/Screen-qu-est-ce-donc.html</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>** Reference : http://www.linux-nantes.org/Screen-qu-est-ce-donc.html</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
</table>
Samneurohack
https://www.tmplab.org/wiki/index.php?title=Cluster&diff=5434&oldid=prev
Samneurohack: /* Genome database */
2013-10-05T18:31:59Z
<p><span dir="auto"><span class="autocomment">Genome database</span></span></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class="diff-marker" />
<col class="diff-content" />
<col class="diff-marker" />
<col class="diff-content" />
<tr style="vertical-align: top;" lang="en">
<td colspan="2" style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan="2" style="background-color: white; color:black; text-align: center;">Revision as of 18:31, 5 October 2013</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l174" >Line 174:</td>
<td colspan="2" class="diff-lineno">Line 174:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>== Genome database ==</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>== Genome database ==</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>[http://www.tmplab.org/wiki/index.php/GTA]</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>[http://www.tmplab.org/wiki/index.php/<ins class="diffchange diffchange-inline">GTA </ins>GTA]</div></td></tr>
</table>
Samneurohack
https://www.tmplab.org/wiki/index.php?title=Cluster&diff=5433&oldid=prev
Samneurohack at 14:37, 5 October 2013
2013-10-05T14:37:34Z
<p></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class="diff-marker" />
<col class="diff-content" />
<col class="diff-marker" />
<col class="diff-content" />
<tr style="vertical-align: top;" lang="en">
<td colspan="2" style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan="2" style="background-color: white; color:black; text-align: center;">Revision as of 14:37, 5 October 2013</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l174" >Line 174:</td>
<td colspan="2" class="diff-lineno">Line 174:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>== Genome database ==</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>== Genome database ==</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">Ensembl :</del></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">[http</ins>://<ins class="diffchange diffchange-inline">www</ins>.<ins class="diffchange diffchange-inline">tmplab</ins>.org/<ins class="diffchange diffchange-inline">wiki</ins>/<ins class="diffchange diffchange-inline">index</ins>.<ins class="diffchange diffchange-inline">php</ins>/<ins class="diffchange diffchange-inline">GTA]</ins></div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div> </div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">Sam : ftp</del>://<del class="diffchange diffchange-inline">ftp</del>.<del class="diffchange diffchange-inline">ensembl</del>.org/<del class="diffchange diffchange-inline">pub/data_files/anolis_carolinensis</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">        : ftp://ftp.ensembl.org/pub/data_files/canis_familiaris</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">        : ftp:/</del>/<del class="diffchange diffchange-inline">ftp</del>.<del class="diffchange diffchange-inline">ensembl.org/pub/data_files/danio_rerio</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">        : ftp://ftp.ensembl.org/pub/data_files/felis_catus</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">        : ftp://ftp.ensembl.org/pub/data_files/ficedula_albicollis</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">        : ftp://ftp.ensembl.org/pub/data_files/gallus_gallus</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">        : ftp://ftp.ensembl.org/pub/data_files/homo_sapiens</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">        : ftp://ftp.ensembl.org/pub/data_files/latimeria_chalumnae</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">        : ftp://ftp.ensembl.org/pub/data_files/monodelphis_domestica</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">        : ftp://ftp.ensembl.org/pub/data_files/mus_musculus</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">        : ftp://ftp.ensembl.org/pub/data_files/mustela_putorius_furo</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">        : ftp://ftp.ensembl.org/pub/data_files/nomascus_leucogenys</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">        : ftp://ftp.ensembl.org/pub/data_files/oreochromis_niloticus</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">        : ftp://ftp.ensembl.org/pub/data_files/ornithorhynchus_anatinus</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">        : ftp://ftp.ensembl.org/pub/data_files/oryctolagus_cuniculus</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">        : ftp://ftp.ensembl.org/pub/data_files/pan_troglodytes</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">        : ftp://ftp.ensembl.org/pub/data_files/pelodiscus_sinensis</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">        : ftp://ftp.ensembl.org/pub/data_files/pongo_abelii</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">        : ftp://ftp.ensembl.org/pub/data_files/sarcophilus_harrisii</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">        : ftp://ftp.ensembl.org/pub/data_files/sus_scrofa</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">        : ftp://ftp.ensembl.org/pub/data_files</del>/<del class="diffchange diffchange-inline">xiphophorus_maculatus</del></div></td><td colspan="2"> </td></tr>
</table>
Samneurohack
https://www.tmplab.org/wiki/index.php?title=Cluster&diff=5431&oldid=prev
Samneurohack at 13:51, 5 October 2013
2013-10-05T13:51:05Z
<p></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class="diff-marker" />
<col class="diff-content" />
<col class="diff-marker" />
<col class="diff-content" />
<tr style="vertical-align: top;" lang="en">
<td colspan="2" style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan="2" style="background-color: white; color:black; text-align: center;">Revision as of 13:51, 5 October 2013</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l171" >Line 171:</td>
<td colspan="2" class="diff-lineno">Line 171:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>samtools mpileup -uf ref.fasta out.bam | bcftools view -cg - | vcfutils.pl vcf2fq > cns.fq</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>samtools mpileup -uf ref.fasta out.bam | bcftools view -cg - | vcfutils.pl vcf2fq > cns.fq</div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">== Genome database ==</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">Ensembl :</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">Sam : ftp://ftp.ensembl.org/pub/data_files/anolis_carolinensis</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">        : ftp://ftp.ensembl.org/pub/data_files/canis_familiaris</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">        : ftp://ftp.ensembl.org/pub/data_files/danio_rerio</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">        : ftp://ftp.ensembl.org/pub/data_files/felis_catus</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">        : ftp://ftp.ensembl.org/pub/data_files/ficedula_albicollis</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">        : ftp://ftp.ensembl.org/pub/data_files/gallus_gallus</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">        : ftp://ftp.ensembl.org/pub/data_files/homo_sapiens</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">        : ftp://ftp.ensembl.org/pub/data_files/latimeria_chalumnae</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">        : ftp://ftp.ensembl.org/pub/data_files/monodelphis_domestica</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">        : ftp://ftp.ensembl.org/pub/data_files/mus_musculus</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">        : ftp://ftp.ensembl.org/pub/data_files/mustela_putorius_furo</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">        : ftp://ftp.ensembl.org/pub/data_files/nomascus_leucogenys</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">        : ftp://ftp.ensembl.org/pub/data_files/oreochromis_niloticus</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">        : ftp://ftp.ensembl.org/pub/data_files/ornithorhynchus_anatinus</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">        : ftp://ftp.ensembl.org/pub/data_files/oryctolagus_cuniculus</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">        : ftp://ftp.ensembl.org/pub/data_files/pan_troglodytes</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">        : ftp://ftp.ensembl.org/pub/data_files/pelodiscus_sinensis</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">        : ftp://ftp.ensembl.org/pub/data_files/pongo_abelii</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">        : ftp://ftp.ensembl.org/pub/data_files/sarcophilus_harrisii</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">        : ftp://ftp.ensembl.org/pub/data_files/sus_scrofa</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">        : ftp://ftp.ensembl.org/pub/data_files/xiphophorus_maculatus</ins></div></td></tr>
</table>
Samneurohack
https://www.tmplab.org/wiki/index.php?title=Cluster&diff=5430&oldid=prev
Samneurohack: /* Guide de survie */
2013-10-04T21:10:10Z
<p><span dir="auto"><span class="autocomment">Guide de survie</span></span></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class="diff-marker" />
<col class="diff-content" />
<col class="diff-marker" />
<col class="diff-content" />
<tr style="vertical-align: top;" lang="en">
<td colspan="2" style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan="2" style="background-color: white; color:black; text-align: center;">Revision as of 21:10, 4 October 2013</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l83" >Line 83:</td>
<td colspan="2" class="diff-lineno">Line 83:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* Pour voir les specs depuis ssh : more /proc/cpuinfo et more /proc/meminfo</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* Pour voir les specs depuis ssh : more /proc/cpuinfo et more /proc/meminfo</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* Ajouter un disque en ligne de [http://www.ghacks.net/2009/09/10/add-a-second-drive-to-your-ubuntu-server/ commande]</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* Ajouter un disque en ligne de [http://www.ghacks.net/2009/09/10/add-a-second-drive-to-your-ubuntu-server/ commande]</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>* ftp recursif : wget -r --user %user% --password %password% ftp://%server%/full/path</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>* <ins class="diffchange diffchange-inline">telechargement ''</ins>ftp<ins class="diffchange diffchange-inline">'' </ins>recursif : wget -r --user %user% --password %password% ftp://%server%/full/path</div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">* Utilisation de screen pour detacher un "terminal", recuperable en cas de perte de connexion :</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">** Création d'un terminal detachable sur la cible : screen</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">** Détacher un terminal : CTRL-A d</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">** Lister les terminaux mémorisés sur la cible : screen -ls</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">** Se reconnecter sur un terminal détaché : screen -r</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">** Lister les terminaux créée depuis un terminal détaché : CTRL-A "</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">** Reference : http://www.linux-nantes.org/Screen-qu-est-ce-donc.html</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>== Outils de benchmark  ==</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>== Outils de benchmark  ==</div></td></tr>
</table>
Samneurohack
https://www.tmplab.org/wiki/index.php?title=Cluster&diff=5427&oldid=prev
Samneurohack: /* Guide de survie */
2013-10-04T09:23:22Z
<p><span dir="auto"><span class="autocomment">Guide de survie</span></span></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class="diff-marker" />
<col class="diff-content" />
<col class="diff-marker" />
<col class="diff-content" />
<tr style="vertical-align: top;" lang="en">
<td colspan="2" style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan="2" style="background-color: white; color:black; text-align: center;">Revision as of 09:23, 4 October 2013</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l79" >Line 79:</td>
<td colspan="2" class="diff-lineno">Line 79:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* Pour se connecter depuis le réseau : ssh login@machine</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* Pour se connecter depuis le réseau : ssh login@machine</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* Pour redémarrer un serveur depuis ssh : sudo reboot</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* Pour redémarrer un serveur depuis ssh : sudo reboot</div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">* Pourquoi ** le systeme doit etre redémarre ** : cat /var/run/reboot-required.pkgs</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* Pour éteindre un serveur depuis ssh : sudo shutdown -h now</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* Pour éteindre un serveur depuis ssh : sudo shutdown -h now</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* Pour voir les specs depuis ssh : more /proc/cpuinfo et more /proc/meminfo</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* Pour voir les specs depuis ssh : more /proc/cpuinfo et more /proc/meminfo</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* Ajouter un disque en ligne de [http://www.ghacks.net/2009/09/10/add-a-second-drive-to-your-ubuntu-server/ commande]</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* Ajouter un disque en ligne de [http://www.ghacks.net/2009/09/10/add-a-second-drive-to-your-ubuntu-server/ commande]</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">* Pourquoi ** le systeme doit etre redémarre ** : cat /var/run/reboot-required.pkgs</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* ftp recursif : wget -r --user %user% --password %password% ftp://%server%/full/path</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* ftp recursif : wget -r --user %user% --password %password% ftp://%server%/full/path</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
</table>
Samneurohack
https://www.tmplab.org/wiki/index.php?title=Cluster&diff=5426&oldid=prev
Samneurohack: /* Guide de survie */
2013-10-04T09:22:52Z
<p><span dir="auto"><span class="autocomment">Guide de survie</span></span></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class="diff-marker" />
<col class="diff-content" />
<col class="diff-marker" />
<col class="diff-content" />
<tr style="vertical-align: top;" lang="en">
<td colspan="2" style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan="2" style="background-color: white; color:black; text-align: center;">Revision as of 09:22, 4 October 2013</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l83" >Line 83:</td>
<td colspan="2" class="diff-lineno">Line 83:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* Ajouter un disque en ligne de [http://www.ghacks.net/2009/09/10/add-a-second-drive-to-your-ubuntu-server/ commande]</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* Ajouter un disque en ligne de [http://www.ghacks.net/2009/09/10/add-a-second-drive-to-your-ubuntu-server/ commande]</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* Pourquoi ** le systeme doit etre redémarre ** : cat /var/run/reboot-required.pkgs</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* Pourquoi ** le systeme doit etre redémarre ** : cat /var/run/reboot-required.pkgs</div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">* ftp recursif : wget -r --user %user% --password %password% ftp://%server%/full/path</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>== Outils de benchmark  ==</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>== Outils de benchmark  ==</div></td></tr>
</table>
Samneurohack
https://www.tmplab.org/wiki/index.php?title=Cluster&diff=5425&oldid=prev
Samneurohack: /* Guide de survie */
2013-10-04T08:22:25Z
<p><span dir="auto"><span class="autocomment">Guide de survie</span></span></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class="diff-marker" />
<col class="diff-content" />
<col class="diff-marker" />
<col class="diff-content" />
<tr style="vertical-align: top;" lang="en">
<td colspan="2" style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan="2" style="background-color: white; color:black; text-align: center;">Revision as of 08:22, 4 October 2013</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l82" >Line 82:</td>
<td colspan="2" class="diff-lineno">Line 82:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* Pour voir les specs depuis ssh : more /proc/cpuinfo et more /proc/meminfo</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* Pour voir les specs depuis ssh : more /proc/cpuinfo et more /proc/meminfo</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* Ajouter un disque en ligne de [http://www.ghacks.net/2009/09/10/add-a-second-drive-to-your-ubuntu-server/ commande]</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>* Ajouter un disque en ligne de [http://www.ghacks.net/2009/09/10/add-a-second-drive-to-your-ubuntu-server/ commande]</div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins style="font-weight: bold; text-decoration: none;">* Pourquoi ** le systeme doit etre redémarre ** : cat /var/run/reboot-required.pkgs</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>== Outils de benchmark  ==</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>== Outils de benchmark  ==</div></td></tr>
</table>
Samneurohack
https://www.tmplab.org/wiki/index.php?title=Cluster&diff=5424&oldid=prev
Samneurohack: /* Outils de management */
2013-10-04T00:46:30Z
<p><span dir="auto"><span class="autocomment">Outils de management</span></span></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class="diff-marker" />
<col class="diff-content" />
<col class="diff-marker" />
<col class="diff-content" />
<tr style="vertical-align: top;" lang="en">
<td colspan="2" style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan="2" style="background-color: white; color:black; text-align: center;">Revision as of 00:46, 4 October 2013</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l138" >Line 138:</td>
<td colspan="2" class="diff-lineno">Line 138:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>A faire :</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>A faire :</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;"></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">-Installation des 3 dernières machines</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;"></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">-modifier les routes pour un point d'acces unique a partir de l'exterieur.</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>-Montage du file system NFS</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>-Montage du file system NFS</div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;"></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del style="font-weight: bold; text-decoration: none;">-Benchmark des performances reseau</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>-Envoyer un rat sur la Lune</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>-Envoyer un rat sur la Lune</div></td></tr>
</table>
Samneurohack
https://www.tmplab.org/wiki/index.php?title=Cluster&diff=5329&oldid=prev
Samneurohack: /* Notre cluster (OUTDATED) */
2013-09-21T19:04:22Z
<p><span dir="auto"><span class="autocomment">Notre cluster (OUTDATED)</span></span></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class="diff-marker" />
<col class="diff-content" />
<col class="diff-marker" />
<col class="diff-content" />
<tr style="vertical-align: top;" lang="en">
<td colspan="2" style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan="2" style="background-color: white; color:black; text-align: center;">Revision as of 19:04, 21 September 2013</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l8" >Line 8:</td>
<td colspan="2" class="diff-lineno">Line 8:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>== Notre cluster (OUTDATED) ==</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>== Notre cluster (OUTDATED) ==</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>online computers : <del class="diffchange diffchange-inline">12 </del></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>online computers : <ins class="diffchange diffchange-inline">15</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Racks (SM : Supermicro) :</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Racks (SM : Supermicro) :</div></td></tr>
</table>
Samneurohack
https://www.tmplab.org/wiki/index.php?title=Cluster&diff=5328&oldid=prev
Samneurohack: /* Notre cluster (OUTDATED) */
2013-09-21T19:03:43Z
<p><span dir="auto"><span class="autocomment">Notre cluster (OUTDATED)</span></span></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class="diff-marker" />
<col class="diff-content" />
<col class="diff-marker" />
<col class="diff-content" />
<tr style="vertical-align: top;" lang="en">
<td colspan="2" style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan="2" style="background-color: white; color:black; text-align: center;">Revision as of 19:03, 21 September 2013</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l29" >Line 29:</td>
<td colspan="2" class="diff-lineno">Line 29:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Rosalie : Online</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Rosalie : Online</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>Garence : online. Serveur de stockage : <del class="diffchange diffchange-inline">2</del>.5 To. Reste <del class="diffchange diffchange-inline">4 </del>berceaux sata vides.</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>Garence : online. Serveur de stockage : <ins class="diffchange diffchange-inline">4</ins>.5 To. Reste <ins class="diffchange diffchange-inline">3 </ins>berceaux sata vides.</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>== Les logiciels ==</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>== Les logiciels ==</div></td></tr>
</table>
Samneurohack
https://www.tmplab.org/wiki/index.php?title=Cluster&diff=5326&oldid=prev
Samneurohack: /* Objectif */
2013-09-21T18:59:46Z
<p><span dir="auto"><span class="autocomment">Objectif</span></span></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class="diff-marker" />
<col class="diff-content" />
<col class="diff-marker" />
<col class="diff-content" />
<tr style="vertical-align: top;" lang="en">
<td colspan="2" style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan="2" style="background-color: white; color:black; text-align: center;">Revision as of 18:59, 21 September 2013</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l1" >Line 1:</td>
<td colspan="2" class="diff-lineno">Line 1:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>= Objectif =</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>= Objectif =</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div><del class="diffchange diffchange-inline">cf [[Biocluster_:_alignement]]</del></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">Cluster multi usages, accessible online. </ins></div></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div> </div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline">En ce moment calculs mpi en génétique, rendering blender, stockage de génomes.</ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div><ins class="diffchange diffchange-inline"> </ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Documentation de référence : [http://techtinkering.com/2009/12/02/setting-up-a-beowulf-cluster-using-open-mpi-on-linux/ Setting up a Beowulf cluster using openmpi on linux]</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Documentation de référence : [http://techtinkering.com/2009/12/02/setting-up-a-beowulf-cluster-using-open-mpi-on-linux/ Setting up a Beowulf cluster using openmpi on linux]</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
</table>
Samneurohack
https://www.tmplab.org/wiki/index.php?title=Cluster&diff=5325&oldid=prev
Samneurohack: /* Notre cluster */
2013-09-21T18:55:01Z
<p><span dir="auto"><span class="autocomment">Notre cluster</span></span></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class="diff-marker" />
<col class="diff-content" />
<col class="diff-marker" />
<col class="diff-content" />
<tr style="vertical-align: top;" lang="en">
<td colspan="2" style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan="2" style="background-color: white; color:black; text-align: center;">Revision as of 18:55, 21 September 2013</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l5" >Line 5:</td>
<td colspan="2" class="diff-lineno">Line 5:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Documentation de référence : [http://techtinkering.com/2009/12/02/setting-up-a-beowulf-cluster-using-open-mpi-on-linux/ Setting up a Beowulf cluster using openmpi on linux]</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Documentation de référence : [http://techtinkering.com/2009/12/02/setting-up-a-beowulf-cluster-using-open-mpi-on-linux/ Setting up a Beowulf cluster using openmpi on linux]</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>== Notre cluster ==</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>== Notre cluster <ins class="diffchange diffchange-inline">(OUTDATED) </ins>==</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>online computers : 12 <del class="diffchange diffchange-inline">(OUTDATED)</del></div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>online computers : 12  </div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Racks (SM : Supermicro) :</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Racks (SM : Supermicro) :</div></td></tr>
</table>
Samneurohack
https://www.tmplab.org/wiki/index.php?title=Cluster&diff=5324&oldid=prev
Samneurohack: /* Notre cluster */
2013-09-21T18:54:36Z
<p><span dir="auto"><span class="autocomment">Notre cluster</span></span></p>
<table class="diff diff-contentalign-left" data-mw="interface">
<col class="diff-marker" />
<col class="diff-content" />
<col class="diff-marker" />
<col class="diff-content" />
<tr style="vertical-align: top;" lang="en">
<td colspan="2" style="background-color: white; color:black; text-align: center;">← Older revision</td>
<td colspan="2" style="background-color: white; color:black; text-align: center;">Revision as of 18:54, 21 September 2013</td>
</tr><tr><td colspan="2" class="diff-lineno" id="mw-diff-left-l7" >Line 7:</td>
<td colspan="2" class="diff-lineno">Line 7:</td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>== Notre cluster ==</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>== Notre cluster ==</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'>−</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #ffe49c; vertical-align: top; white-space: pre-wrap;"><div>online computers : 12</div></td><td class='diff-marker'>+</td><td style="color:black; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #a3d3ff; vertical-align: top; white-space: pre-wrap;"><div>online computers : 12 <ins class="diffchange diffchange-inline">(OUTDATED)</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Racks (SM : Supermicro) :</div></td><td class='diff-marker'> </td><td style="background-color: #f9f9f9; color: #333333; font-size: 88%; border-style: solid; border-width: 1px 1px 1px 4px; border-radius: 0.33em; border-color: #e6e6e6; vertical-align: top; white-space: pre-wrap;"><div>Racks (SM : Supermicro) :</div></td></tr>
</table>
Samneurohack
https://www.tmplab.org/wiki/index.php?title=Cluster&diff=5323&oldid=prev
Samneurohack: New page: = Objectif = cf Biocluster_:_alignement Documentation de référence : [http://techtinkering.com/2009/12/02/setting-up-a-beowulf-cluster-using-open-mpi-on-linux/ Setting up a Beowulf...
2013-09-21T18:54:05Z
<p>New page: = Objectif = cf <a href="/wiki/index.php?title=Biocluster_:_alignement&action=edit&redlink=1" class="new" title="Biocluster : alignement (page does not exist)">Biocluster_:_alignement</a> Documentation de référence : [http://techtinkering.com/2009/12/02/setting-up-a-beowulf-cluster-using-open-mpi-on-linux/ Setting up a Beowulf...</p>
<p><b>New page</b></p><div>= Objectif =<br />
<br />
cf [[Biocluster_:_alignement]]<br />
<br />
Documentation de référence : [http://techtinkering.com/2009/12/02/setting-up-a-beowulf-cluster-using-open-mpi-on-linux/ Setting up a Beowulf cluster using openmpi on linux]<br />
<br />
== Notre cluster ==<br />
<br />
online computers : 12<br />
<br />
Racks (SM : Supermicro) :<br />
# thérèse SM : Online<br />
# madeleine HP : A reinstaller grub ne passe pas. eth0 est le port du bas -> OK (1 Go ECC) 2.26 Ghz<br />
# ursuline SM : Online F1:04:8 doit être reset pour voir son HD MPI ip=210<br />
# marcelle SM : Online 54:a8:ad SATA 256 Go (1 Go DDR 2) 2x1.86 Ghz MPI <br />
# martine HP : OFF (bruit) Online B3:DB:79 (1 GO ECC) eth0 (en bas)<br />
# marlene : A installer utiliser RJ 45 pres USB ports 2x3 Ghz2 Go<br />
# blanche HP : Online F0:D9:A7 1.4 Ghz 34 Go MPI ip=215<br />
# hortense SM : Online 51:C0:BD eth de droite Free IDE. P4 2.0 Ghz 768 Mo PC 133 80 Go MPI _ ip=216<br />
# georgina : Online 90:77:AB P4 2.8 Ghz 512 Mo DDR 333 Eth de droite MPI<br />
<br />
ATX : <br />
# leopold : Online finir installer clefs ssh/blender/repertoires<br />
# sidonia : 4x 3 Ghz Online finir installer clefs ssh/blender/repertoires<br />
# beast : Online 62:A3:D7 MPI ip=228<br />
# watson : Online 2A:FB:51 MPI ip=225<br />
<br />
Rosalie : Online<br />
<br />
Garence : online. Serveur de stockage : 2.5 To. Reste 4 berceaux sata vides.<br />
<br />
== Les logiciels ==<br />
<br />
* Ubuntu server 12.04 LTS<br />
* clustalw-mpi<br />
* openmpi <br />
* blender<br />
<br />
== Installation d'une machine esclave ==<br />
<br />
# Installer ubuntu server 12.04 (voir [http://pastebin.com/MkaqpRMe script de configuration du serveur PXE]). <br />
#* Connecter le serveur sur le petit switch bleu sur watson. <br />
#* Démarrer le serveur, verifier que le bios autorise lan boot rom <br />
#* Sélectionner F12 si besoin (pxe boot) : le serveur doit afficher sa mac adress <br />
#* Se logger sur watson<br />
#* Selon la version a installer (standart ou 64 bits) : ./netboot.sh ou ./netboot64.sh<br />
#* Le serveur doit se configurer tout seul et demarrer l'install d'Ubuntu<br />
#* Des que l'install dialogue : brancher la machine esclave sur le gros switch noir pour continuer l'install via Internet<br />
#* Sélectionner le serveur archive ubuntu belgique sans serveur mandataire (serveur fr surchargé)<br />
#* Continuer l'installation avec base server et openssh<br />
#* Nommer la machine d'après [http://geneanneogie.free.fr/prenoms.htm un ancien prénom féminin] <br />
#* Finir le processus puis suivre Post Install<br />
<br />
== Post Install ==<br />
<br />
* Installer les packages de base<br />
apt-get install openmpi1.5 clustalw-mpi puppet make gcc g++ make automake autoconf libtool htop python-setuptools python-scipy<br />
* Creer un utilisateur 'cluster' avec les droits root depuis le compte féminin<br />
sudo adduser cluster<br />
sudo adduser cluster sudo<br />
* Depuis cluster@watson : création des clefs ssh et upload du pack de base (cluster.tar.gz = contenu de /home/cluster/)<br />
* scp cluster.tar.gz cluster@machine:/home/cluster/<br />
* ssh cluster@machine<br />
* ssh-keygen -t rsa<br />
* tar -zxvf cluster.tar.gz<br />
* exit<br />
* cat ~/.ssh/id_rsa.pub | ssh -l remoteuser remoteserver.com 'cat >> ~/.ssh/authorized_keys'<br />
(Automatic Login : rajoute la clef publique en question dans le [http://wp.uberdose.com/2006/10/16/ssh-automatic-login/ .ssh/authorized_keys] )<br />
<br />
*Noter les machines mises sur le reseau avec la correspondance ip/machine.<br />
<br />
== Guide de survie ==<br />
<br />
* Pour lancer un calcul d'alignement : mpirun -np 8 -h mpihosts clustalw-mpi calcul.fasta (sur la baie depuis watson sur 8 processeurs)<br />
* Pour lancer une animation blender : multiblend -b blender/work/nom.blend -s 1 -e 1200 ( pour 1200 frames / nom.blend doit être dans watson/cluster/home/cluster/blender/work/)<br />
* Fichier de configuration de multiblend : /home/cluster/.multiblendrc<br />
* Pour lancer une commande sur la baie : pssh -h lab.hosts commande<br />
* Pour se connecter depuis le réseau : ssh login@machine<br />
* Pour redémarrer un serveur depuis ssh : sudo reboot<br />
* Pour éteindre un serveur depuis ssh : sudo shutdown -h now<br />
* Pour voir les specs depuis ssh : more /proc/cpuinfo et more /proc/meminfo<br />
* Ajouter un disque en ligne de [http://www.ghacks.net/2009/09/10/add-a-second-drive-to-your-ubuntu-server/ commande]<br />
<br />
== Outils de benchmark ==<br />
Pour développer des outils de bench en python<br />
Brian/playdoh/LEela (cf github)<br />
<br />
== Modification du pack de base ==<br />
* Se logger sur cluster@watson<br />
* rajouter répertoires et fichiers dans /home/cluster/<br />
* rm cluster.tar.gz<br />
* Modifier les utilisateurs : chmod -R 777 *<br />
* tar -cvzf cluster.tar.gz<br />
<br />
== Utilisation de clustalw-mpi ==<br />
<br />
Clustalw-mpi permet d'aligner des sequences en fonction de leur similarite, ce qui permet de construire (entre autre), des arbres phylogenetiques.<br />
Clustalw-mpi permet a la difference de clustalw, de travailler sur plusieurs machines en parallele.<br />
L'alignement est realise a partir d'une liste de sequences contenues dans un fichier texte au format qui s'appelle fasta, on le nommera ici monfasta.fasta.<br />
<br />
<br />
>sequence_a<br />
<br />
aaatccccgggggccccccc<br />
<br />
>sequence_b<br />
<br />
aatcccccccccccccccc<br />
<br />
>etc ...<br />
<br />
Apres avoir installé openmpi (voir plus haut) et clustalw-mpi sur toutes les machines via : apt-get install clustalw-mpi<br />
<br />
<br />
# On va copier le fichier fasta sur toutes les machines, car le nfs qui est le systeme de fichier partage n'a pas encore ete installe.<br />
# Lancer lamboot sur chaque machine.<br />
<br />
Lancer un calcul : <br />
# mpirun -np 7 -H insuline@insuline,denis@denis,beat@beat clustalw-mpi file-result.txt<br />
# ou mpirun --hostfile mpihosts clustalw-mpi file-result.txt <br />
<br />
Le resultat est affiche sur le terminal, on a la production de deux fichiers, monfasta.dnd, c'est un dendogramme qu'on va utiliser pour construire l'arbre ensuite, et monfasta.aln qui est l'alignement. On peut le visualiser avec un logiciel comme seaview.<br />
Pour installer seaview, sudo apt-get install seaview.<br />
<br />
<br />
un hostfile, ici "mpihosts" permet de declarer le nombre de processeurs par machine, ressemble a :<br />
<br />
beat@beat slots=4<br />
<br />
white@white slots=1<br />
<br />
...<br />
== Outils de management ==<br />
[http://doc.ubuntu-fr.org/puppet Puppet]<br />
PSSH<br />
clustershell<br />
<br />
A faire :<br />
<br />
-Installation des 3 dernières machines<br />
<br />
-modifier les routes pour un point d'acces unique a partir de l'exterieur.<br />
<br />
-Montage du file system NFS<br />
<br />
-Benchmark des performances reseau<br />
<br />
-Envoyer un rat sur la Lune<br />
<br />
== TOOLBOX genomique ==<br />
<br />
a traduire<br />
<br />
SAM (Sequence Alignment/Map) format is a generic format for storing large nucleotide sequence alignments. SAM aims to be a format that:<br />
<br />
Is flexible enough to store all the alignment information generated by various alignment programs;<br />
Is simple enough to be easily generated by alignment programs or converted from existing alignment formats;<br />
Is compact in file size;<br />
Allows most of operations on the alignment to work on a stream without loading the whole alignment into memory;<br />
Allows the file to be indexed by genomic position to efficiently retrieve all reads aligning to a locus. <br />
<br />
SAM Tools provide various utilities for manipulating alignments in the SAM format, including sorting, merging, indexing and generating alignments in a per-position format.<br />
<br />
Comment extraire l'ADN "mitochondrial.fasta" d'un exome téléchargé sur http://www.1000genomes.org/<br />
<br />
samtools view -b HG01879.mapped.ILLUMINA.bwa.ACB.exome.20120522.bam 'MT' > out.bam<br />
<br />
samtools mpileup -uf ref.fasta out.bam | bcftools view -cg - | vcfutils.pl vcf2fq > cns.fq</div>
Samneurohack